This tool identifies identites, differences, and precent identity in a list of input (aligned) sequences.
instructions: enter the aligned sequence data from the alignment output found in the desired cluster's phage_comparison.pptx output
the kalign software used to produce the alignment sometimes separtes sequences onto multipl lines, make sure to copy in all and only the pertinent data, in order and in its original format.
note: This tool does not "realign" the selected sequences, and relies on data determined based off of the population alignment on not alignment of the selected sequences, please record this note in your research
example:
Bipper_tRNA1 ggggcggtagctcagtcggttagagccacggactcataatccgttggtcgtgggttcgag Bipper_tRNA2 ggggcggtagctcagtcggttagagccacggactcataatccgttggtcgtgggttcgag Typha_tRNA2 ggggtggtagctcagatggtcagagccacggactcataatccgtaggtcgcgggttcaag Typha_tRNA3 ggggtggtagctcagatggtcagagccacggactcataatccgtaggtcgcgggttcaag Bipper_tRNA1 ccccacccgccctac Bipper_tRNA2 ccccacccgccctac Typha_tRNA2 tcccgcccaccccac Typha_tRNA3 tcccgcccaccccac