home

Alignment Identity tool

This tool identifies identites, differences, and precent identity in a list of input (aligned) sequences.

instructions: enter the aligned sequence data from the alignment output found in the desired cluster's phage_comparison.pptx output

the kalign software used to produce the alignment sometimes separtes sequences onto multipl lines, make sure to copy in all and only the pertinent data, in order and in its original format.

note: This tool does not "realign" the selected sequences, and relies on data determined based off of the population alignment on not alignment of the selected sequences, please record this note in your research

example:

Bipper_tRNA1     ggggcggtagctcagtcggttagagccacggactcataatccgttggtcgtgggttcgag
Bipper_tRNA2     ggggcggtagctcagtcggttagagccacggactcataatccgttggtcgtgggttcgag
Typha_tRNA2      ggggtggtagctcagatggtcagagccacggactcataatccgtaggtcgcgggttcaag
Typha_tRNA3      ggggtggtagctcagatggtcagagccacggactcataatccgtaggtcgcgggttcaag
Bipper_tRNA1     ccccacccgccctac
Bipper_tRNA2     ccccacccgccctac
Typha_tRNA2      tcccgcccaccccac
Typha_tRNA3      tcccgcccaccccac